Data analysis homework in Biopython

computer science

Description

 Data analysis homework in python

Biopython

1. By accident, a bioinformatics lab mixed up DNA sequences in a single data file for two

organisms: fruit fly (Drosophila melanogaster) and a grape (Vitis vinifera). Your goal is

to figure out which sequences belong to each organism while also learning about the NCBI

databases, specifically BLAS 1. Create a Python program that reads the sequences from a

text file (one per line), performs a BLAST search if not previously done, stores the results

of each search in a separate file, and theii performs analytics on the search results to help

solve our sequiciice mix- up problem. Det ai is:

a. Put a comment at the top of the Python file called Iab5ql with your naine and student

number(s).

h. Download the data file called input.txt and place it in your local directory for reading.

Each hue of the data file contains a DNA sequence. There are 10 iuieuices in the file.

c. (1 uuiark) Read each hue of the (tata file an(l print the first 20 characters in the sequence

and the length of the query sequence to the console.

#

Sample

output

for

a

single sequence:

Sequence:

GGCTGCGGAGACGTTGAAGG Length: 560

(1. (1/2 uuiark) Define a conuiter CallC(l Count to keep track of how many sequences have

l)een processed (t he total count should be 10 once your prograni is complete).

e. (2 marks) Using a try—except clause, look for a previously created BLAST result file

uiauuied dna_Iab5_<count>.xml (for example, dna_Iab5_l.xml). Start the the search

from count=l.

f. (1 mark) If tite file exists, open it 1111(1 print “Using saved file”.

Instruction Files

Related Questions in computer science category